Digital library

Error message

  • Warning: ini_set(): Headers already sent. You cannot change the session module's ini settings at this time in drupal_environment_initialize() (line 695 of /home4/tassusac/public_html/marineagronomy/includes/bootstrap.inc).
  • Warning: ini_set(): Headers already sent. You cannot change the session module's ini settings at this time in drupal_environment_initialize() (line 696 of /home4/tassusac/public_html/marineagronomy/includes/bootstrap.inc).
  • Warning: ini_set(): Headers already sent. You cannot change the session module's ini settings at this time in drupal_environment_initialize() (line 697 of /home4/tassusac/public_html/marineagronomy/includes/bootstrap.inc).
  • Warning: ini_set(): Headers already sent. You cannot change the session module's ini settings at this time in drupal_environment_initialize() (line 700 of /home4/tassusac/public_html/marineagronomy/includes/bootstrap.inc).
  • Warning: ini_set(): Headers already sent. You cannot change the session module's ini settings at this time in drupal_environment_initialize() (line 702 of /home4/tassusac/public_html/marineagronomy/includes/bootstrap.inc).
  • Marine macroalgae Enteromorpha prolifera, one of the main algae genera for green tide, was converted to bio-oil by hydrothermal liquefaction in a batch reactor at temperatures of 220−320 °C. The liquefaction products were separated into a dichloromethane-soluble fraction (bio-oil), water-soluble fraction, solid residue, and gaseous fraction. Effects of the temperature, reaction time, and Na2CO3 catalyst on the yields of liquefaction products were investigated. A moderate temperature of 300 °C with 5 wt % Na2CO3 and reaction time of 30 min led to the highest bio-oil yield of 23.0 wt %. The raw algae and liquefaction products were analyzed using elemental analysis, Fourier transform infrared (FTIR) spectroscopy, gas chromatography−mass spectrometry (GC−MS), and 1H nuclear magnetic resonance (NMR). The higher heating values (HHVs) of bio-oils obtained at 300 °C were around 28−30 MJ/kg. The bio-oil was a complex mixture of ketones, aldehydes, phenols, alkenes, fatty acids, esters, aromatics, and nitrogen-containing heterocyclic compounds. Acetic acid was the main component of the water-soluble products. The results might be helpful to find a possible strategy for use of byproducts of green tide as feedstock for bio-oil production, which should be beneficial for environmental protection and renewable energy development.

    Author(s): Jian-Min Chen, Hongbo Fu, Shicheng Zhang, Liang Zhang, Dong Zhou
  • The search of sustainable and environmentally friendly alternatives to obtain compounds for different industrial sectors has grown exponentially. Following the principles of biorefinery and circular bioeconomy, processes in which the use of natural resources such as macroalgae biomass is prioritized are required. This review focuses on a description of the relevance, application and engineering platforms of hydrothermal systems and the operational conditions depending on the target as an innovative technology and bio-based solution for macroalgae fractionation in order to recover profitable products for industries and investors. In this sense, hydrothermal treatments represent a promising alternative for obtaining different high value-added compounds from this biomass; since, the different variations in terms of operating conditions, gives great versatility to this technology compared to other types of processing, allowing it to be adapted depending on the objective, whether it is working under sub/super critical conditions, thus expanding its field of application.

    Author(s): Blanca E. Morales-Contreras, Noelia Florez-Fernandez , M. Dolores Torres, Herminia Domínguez, Rosa M. Rodríguez-Jasso, Hector A. Ruiz
  • Floating mats of vegetation serve to transfer biomass, nutrients and energy across marine habitats and alter the spectral properties of the sea surface. Here, spectral measurements from the airborne Portable Remote Imaging Spectrometer (PRISM) imagery at 1-m resolution and experimental mesocosms were used to assess the hyperspectral properties of the macroalgae Sargassum and aggregations of the seagrass Syringodium filiforme wrack in Greater Florida Bay. A simple Normalized Difference Vegetative Index (NDVI) effectively discriminated the presence of vegetation floating on the sea surface. The Sargassum Index derived from reflectance ratios at 650 and 630 nm was used to effectively discriminate Sargassum from Syringodium wrack. Mesocosm spectral measurements revealed an initial lowering of wrack reflectance over the first 3 days followed by a subsequent increase in reflectance over the next 8 days. The age of the wrack estimated from 2 to 5 days was best characterized using narrowband indices of the water absorption feature at 930 and 990 nm potentially from increasing water content in wrack leaves over time. Hyperspectral imagery (b10 nm) was necessary to differentiate between these two types of floating vegetation and assess age of the wrack. PRISM imagery revealed seagrass wrack organized in 5–35 m spaced windrows caused by Langmuir circulation. Wrack was only detectable at 60 m pixel resolution when densities were high and individual windrows were in close proximity.

    Author(s): B. Russell, A. Chlus, H.M. Dierssen
  • Coastal environments are prone to nutrient contamination as a result of excessive use of fertilizers in paddy agriculture on the land. To detect nutrient increases in coastal areas, researchers have used hyperspectral reflectance response to examine some coastal plants, which have proved to be effective as bioindicators. In this study, field hyperspectral technique was evaluated as a tool to detect nutrient concentrations in two coastal plants, i.e., seagrass (Enhalus acoroides) and brown algae (Sargassum sp.), taken from Banten Bay Indonesia, at laboratory scale. Although our initial experiments are still too few in elucidating an accurate relationship of nutrients and spectral signature, we are pleased to communicate that there is scientific evidence that hyperspectral measurement can be used to detect nutrient concentrations in coastal vegetation. Two types of fertilizers—urea, which contains 46% nitrogen, and triple super phosphate (TSP), which contains 14–20% soluble P2O5, commonly used by the local paddy farmers—were applied to both coastal plants in the aquarium experiment. The results of factorial analysis of variance (ANOVA) tests and pigmentrelated indices have proved that some significant differences exist in several wavelengths in response to the fertilizer treatments. This study revealed that brown algae were more sensitive to the same amount of fertilizer applied than seagrass.

    Author(s): Agus H. Lesmana, Muhammad Evri, Yuji Sakuno, Kensuke Kawamura, Endan Suwandana
  • The marked increase in occurrences of low oxygen events on continental shelves coupled with observed expansion of low oxygen regions of the ocean has drawn significant scientific and public attention. With this has come the need for the establishment of better definitions for widely used terms such as ‘‘hypoxia’’ and ‘‘dead zones’’. Ocean chemists and physicists use concentration units such as μmolO2=kg for reporting since these units are independent of temperature, salinity and pressure and are required for mass balances and for numerical models of ocean transport. Much of the reporting of dead zone occurrences is in volumetric concentration units of mlO2/l or mgO2/l for historical reasons. And direct measurements of the physiological state of marine animals require reporting of the partial pressure of oxygen (pO2) in matm or kPa since this provides the thermodynamic driving force for molecular transfer through tissue. This necessarily incorporates temperature and salinity terms and thus accommodates changes driven by climate warming and the influence of the very large temperature range around the world where oxygen limiting values are reported. Here we examine the various definitions used and boundaries set and place them within a common framework. We examine the large scale ocean pO2 fields required for pairing with pCO2 data for examination of the combined impacts of ocean acidification and global warming. The term ‘‘dead zones’’, which recently has received considerable attention in both the scientific literature and the press, usually describes shallow, coastal regions of low oxygen caused either by coastal eutrophication and organic matter decomposition or by upwelling of low oxygen waters. While we make clear that bathyal low oxygen waters should not be confused with shallow-water ‘‘dead zones’’, as deep water species are well adapted, we show that those waters represent a global vast reservoir of low oxygen water which can readily be entrained in upwelling waters and contribute to coastal hypoxia around the world and may be characterized identically. We examine the potential for expansion of those water masses onto continental shelves worldwide, thereby crossing limits set for many not adapted species.

    Author(s): A.F. Hofmann, E.T. Peltzer, P.M. Walz, P.G. Brewer
  • Chilean Patagonia is one of the largest estuarine systems in the world. It is characterized by a complex geography of approximately 3,300 islands, a total surface area of 240,000 km2, and 84,000 km of coast line, including islands, peninsulas, channels, fjords, and sounds. The Chilean Patagonia Interior Sea is filled with a mixture of sea, estuarine, and fresh waters, and is characterized by a two layer vertical general circulation. Dissolved oxygen (DO) conditions in these fjords were analyzed based on historic salinity, dissolved oxygen and nutrient data from 1,200 oceanographic stations. Horizontal advection of adjacent well oxygenated Subantarctic Waters (5-6 mL L-1) was the mayor source of DO in the deep layers of the Interior Sea. Incoming DO was consumed by the respiration of autochthonous and allochthonous particulate organic matter, as ocean water flows towards the continental fjord heads, reaching near-hypoxic (2-3 mL L-1) or hypoxic levels (< 2 mL L-1). As DO declined nutrient concentrations increased towards the fjord heads (from ∼ 1.6 μM PO4-3 and ∼ 16 μM NO3- to ∼ 2.4 μM PO4-3 and ∼ 24 μM NO3-). Overall, DO conditions in the Interior Sea were mostly the result of a combination of physical and biogeochemical processes. In all eastern channels and fjords, a low DO zone developed near the fjord heads (< 4 mL L-1) as a result of larger allochthonous particulate organic matter inputs transported by local rivers. This enhanced organic matter input to the deep layer increased DO consumption due to respiration and overwhelmed the oxygen supplied by horizontal advection. Out of the 90 Chilean Patagonian gulfs, channels and fjords analyzed, 86 systems were oxic (> 2 mL L-1) and four hypoxic (< 2 mL L-1), but only at their heads. None were found to be anoxic (0 mL L-1). We found these DO conditions to be permanent features of the Chilean Patagonia Interior Sea.

    Author(s): Nelson Silva , Cristian A. Vargas
  • Inhibition of angiotensin-I-converting enzyme (ACE-I), renin, and dipeptidyl peptidase-IV (DPP-IV) plays a key role in the treatment of hypertension and type-2 diabetes. The aim of this study was to isolate and characterize novel ACE-I, renin, and DPP-IV inhibitory peptides from a papain hydrolysate of bovine serum albumin (BSA). BSA was obtained from whole bovine blood and hydrolyzed with the food-grade enzyme papain. The generated hydrolysate was further purified using ultrafiltration and high performance liquid chromatography (HPLC), and a number of novel bioactive peptides were identified using de novo peptide sequencing. These included SLR, YY, ER, and FR which inhibited the activity of the enzyme ACE-I by half at a concentration of 0.17 ± 0.02, 0.18 ± 0.04, 0.27 ± 0.01, and 0.42 ± 0.02 mM, respectively. In addition, the 1 kDa fraction of the papain hydrolysate was assessed for antihypertensive activity in vivo using spontaneously hypertensive rats (SHRs) and reduced sys- tolic blood pressure over a 24 h period when compared with the control (p b 0.001). Results demonstrated the potential of bovine serum albumin as a source of bioactive peptides with health-promoting properties and poten- tial for use as functional food ingredients.

    Author(s): Tomas Lafarga, Rotimi E. Aluko, Dilip K. Rai, Paula O'Connor, Maria Hayes
  • Muhammad Aris, Identification, pathogenicity of bacteria and the use of gene 16S rRNA for ice-ice detection on seaweed aquaculture (Kappaphycus alvarezii). Supervised by SUKENDA, ENANG HARRIS, M. FATUCHRI SUKADI and MUNTI YUHANA. Ice-ice disease on seaweed aquaculture Kappaphycus alvarezii has a significant effect on decreasing production of seaweed. Decreasing rate of biomass and caragenan content have positive correlation with ice-ice infected thallus weight based on cohabitation test between healthy and infected thallus. Destruction of seaweed tissues occurred in accordance with incubation time of ice-ice disease. Several bacteria had been successfully isolated from infected seaweed thallus and identified using API 20 E and API NE 20 identification test. Isolate of Vibrio alginoliticus PNGK 1 had the higest pathogenicity compared to other species such as Pseudomonas cepacia, Flavobacterium meningosepticum, Pseudomonas diminuta and Plesiomonas shigelloides. V. alginoliticus was significantly display ice-ice symptoms on day 1 after challenge test with dose of 106 CFU/mL. Molecular characterization on V. alginoliticus showed that PNGK 1 isolate similar with V. alginoliticus strain CIFRI V-TSB1. DNA sequencing data of V. alginoliticus PNGK 1 was used as the base of specific primer design for rapid detection of bacteria on seaweed thallus. Results of specific primer design through Primer 3 Program for V. alginoliticus PNGK 1 were primer aSEFM-F ((5- CAGCCACACTGGAACTGAGA -3) and aSEFM-R (5- TTAGCCGGTGCTTCTTCTGT -3). Amplication of V. alginoliticus PNGK 1 DNA resulted in one amplicon 201 bp. Development of rapid detection method on the present of pathogenic bacteria (V. alginoliticus PNGK 1) on seaweed thallus was conducted with several steps optimation test on PCR temperature resulted that at annealing 60oC the DNA of V. alginoliticus PNGK 1 could be detected. Using specifity test and sensitivity with that specific primer it was found a band of 201 bp. This detection method for pathogenic bacteria could be applied for early detectionof asymptoutic ice-ice sea weed. 

    Author(s): MUH. ARIS
  • It is assumed that ewes raised in areas with long indoor winter feeding periods need to be supplemented with vitamins or other substances that help to maintain the health status of the animals. Various supplements are available on the market, but the most widely used supplemental antioxidant and vitamin E source is synthetic all-rac-α-tocopheryl acteate. The objective of the present study was to compare potential vitamin E and immune stimulant sources with synthetic vitamin E regarding bioactivity associated with immunological parameters in order to identify alternatives to synthetic vitamin E for small ruminants. Sources tested were meal of the seaweed Ascophylum nodosum and natural RRR-α-tocopheryl acetate. Forty pregnant ewes were randomly allocated to four treatment group with two replicates (5 ewes in each replicate). The treatments were supplements containing seaweed (SW: 546 Ascophylum nodosum/kg), natural vitamin E (NatE: 562.5 mg RRR-α-tocopheryl acetate/kg), synthetic vitamin E (SyntE: 1125 mg all-rac-α-tocopheryl acetate/kg), or no extra seaweed or vitamin E (control). The supplements were fed at an isoenergetic daily rate, on average 144 g DM/ewe for SW and 114 g DM/ewe for the three other treatments, from mating until start grazing season (200 days). It was assumed that 0.5 mg RRR- α-tocopheryl acetate was equal to 1 IU=1 mg all-rac-α-tocopheryl acetate. The planned supplementation in the SyntE and NatE treatments were 140 IU vitamin E/ewe daily, and the daily supplemental rate was on average for the whole experimental period 20, 146, 121 and 4 IU in SW, SyntE, NatE and C treatments, respectively. The ewes and their newborn lambs were monitored throughout the entire indoor feeding period. Supplementing pregnant ewes with natural vitamin E had a positive effect on immunity against Mycobacterium sp. in the lambs, whereas supplementing ewes with seaweed interfered with the passive immunity of the offspring resulting in a mortality rate of 35%, compared with 10% in C, 5.6% in NatE and 0% in SyntE. The adaptive immunity of the lambs was not affected by seaweed supplementation. In the ewes, it seemed that supplementation with either seaweed, natural vitamin E or synthetic vitamin E had no beneficial health effects, and serum IgG concentrations were reduced in the seaweed treatment group.

    Author(s): H. Steinshamn, E. Govasmark, S.K. Jensen, H.J.S. Larsen, V. Lind, L. Aanensen, M. Novoa-Garrido
  • Low seaweed consumption in the West is due to lack of availability and consumer familiarity. In this study, the effects of preservation processes on quality aspects of Saccharina latissima products were assessed. First, a blanching (100 ◦C for 1 or 3 min) treatment was used to produce seaweed salad. In a second study, effects of blanching, freezing, and fermentation on kelp quality were assessed and processed kelp was used to produce sauerkraut. Blanching significantly decreased (p ≤ 0.05) the instrumental kelp a* value and firmness. The a* value negatively correlated with overall liking of salads. To prepare sauerkraut, raw, raw/frozen (−20 ◦C), blanched (100 ◦C, 1 min), or blanched/frozen kelp were mixed with cabbage, salted, inoculated with starter cultures and fermented. Inconsistent trends in L* values, firmness, and fungi enumeration were observed after fermentation. Consumers evaluated kelp salad (n = 100) and sauerkraut (n = 80) for acceptability. Blanched kelp salad had higher hedonic scores than raw kelp salad. A 100% cabbage sauerkraut control and blanched kelp/cabbage blends were compared; kelp blends were similar to control for appearance, color, and texture but were lower for overall acceptability. Results suggest improved quality and enhanced consumer acceptability of seaweed products with use of minimal processing.

    Author(s): Jennifer J. Perry, Mary E. Camire, Denise I. Skonberg, Samuel Akomea-Frempong

Pages